| trimLRPatterns {Biostrings} | R Documentation |
The trimLRPatterns function trims left and/or right flanking patterns
from sequences.
trimLRPatterns(Lpattern = "", Rpattern = "", subject,
max.Lmismatch = 0, max.Rmismatch = 0,
with.Lindels = FALSE, with.Rindels = FALSE,
Lfixed = TRUE, Rfixed = TRUE, ranges = FALSE)
Lpattern |
The left pattern. |
Rpattern |
The right pattern. |
subject |
An XString object, XStringSet object, or character vector containing the target sequence(s). |
max.Lmismatch |
Either an integer vector of length nLp = nchar(Lpattern) whose
elements max.Lmismatch[i] represent the maximum number of
acceptable mismatching letters when aligning
substring(Lpattern, nLp - i + 1, nLp) with
substring(subject, 1, i) or a single numeric value in
(0, 1) that represents a constant maximum mismatch rate for each
of the nL alignments. Negative numbers in integer vector inputs
are used to prevent trimming at the i-th location. If an integer vector
input has length(max.Lmismatch) < nLp, then max.Lmismatch
will be augmented with enough -1's at the beginning of the vector to
bring it up to length nLp.
If non-zero, an inexact matching algorithm is used (see the
|
max.Rmismatch |
Either an integer vector of length nRp = nchar(Rpattern) whose
elements max.Rmismatch[i] represent the maximum number of
acceptable mismatching letters when aligning
substring(Rpattern, 1, i) with
substring(subject, nS - i + 1, nS), where
nS = nchar(subject), or a single numeric value in
(0, 1) that represents a constant maximum mismatch rate for each
of the nR alignments. Negative numbers in integer vector inputs
are used to prevent trimming at the i-th location. If an integer vector
input has length(max.Rmismatch) < nRp, then max.Rmismatch
will be augmented with enough -1's at the beginning of the vector to
bring it up to length nRp.
If non-zero, an inexact matching algorithm is used (see the
|
with.Lindels |
If TRUE then indels are allowed in the left pattern.
In that case max.Lmismatch is interpreted as the maximum "edit
distance" allowed in the left pattern.
See the |
with.Rindels |
Same as with.Lindels but for the right pattern.
|
Lfixed, Rfixed |
Whether IUPAC extended letters in the left or right pattern should
be interpreted as ambiguities (see ?`lowlevel-matching`
for the details).
|
ranges |
If TRUE, then return the ranges to use to trim subject.
If FALSE, then returned the trimmed subject.
|
A new XString object, XStringSet object, or character vector with the flanking patterns within the specified edit distances removed.
P. Aboyoun
matchPattern,
matchLRPatterns,
lowlevel-matching,
XString-class,
XStringSet-class
Lpattern <- "TTCTGCTTG"
Rpattern <- "GATCGGAAG"
subject <- DNAString("TTCTGCTTGACGTGATCGGA")
subjectSet <- DNAStringSet(c("TGCTTGACGGCAGATCGG", "TTCTGCTTGGATCGGAAG"))
## Only allow for perfect matches on the flanks
trimLRPatterns(Lpattern = Lpattern, subject = subject)
trimLRPatterns(Rpattern = Rpattern, subject = subject)
trimLRPatterns(Lpattern = Lpattern, Rpattern = Rpattern, subject = subjectSet)
## Allow for perfect matches on the flanking overlaps
trimLRPatterns(Lpattern = Lpattern, Rpattern = Rpattern, subject = subjectSet,
max.Lmismatch = rep(0, 9), max.Rmismatch = rep(0, 9))
## Allow for mismatches on the flanks
trimLRPatterns(Lpattern = Lpattern, Rpattern = Rpattern, subject = subject,
max.Lmismatch = 0.2, max.Rmismatch = 0.2)
maxMismatches <- as.integer(0.2 * 1:9)
maxMismatches
trimLRPatterns(Lpattern = Lpattern, Rpattern = Rpattern, subject = subjectSet,
max.Lmismatch = maxMismatches, max.Rmismatch = maxMismatches)
## Produce ranges that can be an input into other functions
trimLRPatterns(Lpattern = Lpattern, Rpattern = Rpattern, subject = subjectSet,
max.Lmismatch = rep(0, 9), max.Rmismatch = rep(0, 9),
ranges = TRUE)
trimLRPatterns(Lpattern = Lpattern, Rpattern = Rpattern, subject = subject,
max.Lmismatch = 0.2, max.Rmismatch = 0.2, ranges = TRUE)